pcdna 3 1 Search Results


pcdna3 1 myc  (Addgene inc)
93
Addgene inc pcdna3 1 myc
Pcdna3 1 Myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/pcDNA3%2E1%2FMyc-His(-)-HSulf-1+deltaCC+(Plasmid+%2313005)/pmc03341932-203-1-9
Average 93 stars, based on 1 article reviews
pcdna3 1 myc - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier
3xflag ifit5 addgene addgene plasmid  (Addgene inc)
92
Addgene inc 3xflag ifit5 addgene addgene plasmid
Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, <t>FLAG-IFIT5,</t> influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.
3xflag Ifit5 Addgene Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/pcDNA3%2E1+3xFlag+IFIT1+(Plasmid+%2353554)/pm37683630-526-88-90
Average 92 stars, based on 1 article reviews
3xflag ifit5 addgene addgene plasmid - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier
e schreiter  (Addgene inc)
91
Addgene inc e schreiter
Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, <t>FLAG-IFIT5,</t> influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.
E Schreiter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/pCDNA3%2E1-H-Luc_nucl+(Plasmid+%23113931)/pm37291200-291-22-27
Average 91 stars, based on 1 article reviews
e schreiter - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier
pcdna3 1 prdm16  (Addgene inc)
92
Addgene inc pcdna3 1 prdm16
Schematic representation of plasmid map pAAV-FoxP4, <t>pAAV-PRDM16,</t> and pAAV-FST.
Pcdna3 1 Prdm16, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/pcDNA3%2E1+PRDM16+(Plasmid+%2315503)/pmc11594101-131-11-13
Average 92 stars, based on 1 article reviews
pcdna3 1 prdm16 - by Bioz Stars, 2026-10
92/100 stars
  Buy from Supplier
pyruvate  (Addgene inc)
93
Addgene inc pyruvate
Schematic representation of plasmid map pAAV-FoxP4, <t>pAAV-PRDM16,</t> and pAAV-FST.
Pyruvate, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/Pyronic%2FpcDNA3%2E1(-)+(Plasmid+%2351308)/bio_rxiv__2021__02__02__429391-267-47-49
Average 93 stars, based on 1 article reviews
pyruvate - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier
plasmid pcdna3 1 hnox4  (Addgene inc)
93
Addgene inc plasmid pcdna3 1 hnox4
Schematic representation of plasmid map pAAV-FoxP4, <t>pAAV-PRDM16,</t> and pAAV-FST.
Plasmid Pcdna3 1 Hnox4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/pcDNA3%2E1-hNox4+(Plasmid+%2369352)/bio_rxiv__2023__06__06__543425-81-11-17
Average 93 stars, based on 1 article reviews
plasmid pcdna3 1 hnox4 - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier
pcdna3 1  (Addgene inc)
95
Addgene inc pcdna3 1
Schematic representation of plasmid map pAAV-FoxP4, <t>pAAV-PRDM16,</t> and pAAV-FST.
Pcdna3 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/pcDNA3%2E1-hACE2+(Plasmid+%23145033)/pm34510494-312-18-51
Average 95 stars, based on 1 article reviews
pcdna3 1 - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier
addgene plasmid  (Addgene inc)
91
Addgene inc addgene plasmid
Schematic representation of plasmid map pAAV-FoxP4, <t>pAAV-PRDM16,</t> and pAAV-FST.
Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/wt+HA-dynamin+2+pcDNA3%2E1+(Plasmid+%2334684)/pmc12159506-124-6-6
Average 91 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars, 2026-10
91/100 stars
  Buy from Supplier
pcdna3 1 plasmid  (Addgene inc)
93
Addgene inc pcdna3 1 plasmid
Schematic representation of plasmid map pAAV-FoxP4, <t>pAAV-PRDM16,</t> and pAAV-FST.
Pcdna3 1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/pcDNA3%2E1(-)+FLIPQTV3%2E0+(Plasmid+%2363731)/pm38649430-283-11-16
Average 93 stars, based on 1 article reviews
pcdna3 1 plasmid - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier
pcdna3 1 peredox mcherry nls  (Addgene inc)
94
Addgene inc pcdna3 1 peredox mcherry nls
Schematic representation of plasmid map pAAV-FoxP4, <t>pAAV-PRDM16,</t> and pAAV-FST.
Pcdna3 1 Peredox Mcherry Nls, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/pcDNA3%2E1-Peredox-mCherry-NLS+(Plasmid+%2332384)/bio_rxiv__2021__08__27__457974-235-7-8
Average 94 stars, based on 1 article reviews
pcdna3 1 peredox mcherry nls - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier
g4 q118r dual pegrna  (Addgene inc)
93
Addgene inc g4 q118r dual pegrna
Schematic representation of plasmid map pAAV-FoxP4, <t>pAAV-PRDM16,</t> and pAAV-FST.
G4 Q118r Dual Pegrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna+3+1/Neurl1Rm-Flag+pcDNA3%2E1+(Plasmid+%2317319)/bio_rxiv__2021__11__02__464583-219-19-20
Average 93 stars, based on 1 article reviews
g4 q118r dual pegrna - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

Image Search Results


Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, FLAG-IFIT5, influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.

Journal: Developmental cell

Article Title: Usp25-Erlin1/2 activity limits cholesterol flux to restrict virus infection.

doi: 10.1016/j.devcel.2023.08.013

Figure Lengend Snippet: Figure 6. Usp25 interacts with and stabilizes the Erlin1/2 complex (A) FLAG-Usp25 expressed in A549 cells were either mock infected or H1N1pdm-infected (MOI = 1). Usp25 was immunoprecipitated from mock and H1N1pdm- infected cells on anti-FLAG M2 affinity beads and trypsin digested to identify interactors using mass spectrometry. Volcano plots indicate protein enrichments in mock and H1N1pdm-infected cells. (B) Candidates with the highest number of unique peptides were isolated specifically from H1N1pdm-infected cells. (C) A549 cells expressing either FLAG-tag or FLAG-Usp25WT were either mock infected or H1N1pdm infected. Expression of Erlin1 and Erlin2 were measured by immunoblotting. Gapdh levels measured as loading control. A549 cells either Usp25/, or expressing Usp25WT or Usp25C178S were mock or H1N1pdm infected, and Erlin2 expression measured by immunoblotting. (D and E) IAV-infected A549 cells either Usp25/ or expressing Usp25WT or Usp25C178S were pulsed with [35S]cysteine/methionine and chased for indicated time intervals. At each time point, Erlin1/2 was immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. (F) HEK-293T cell extracts, transiently co-transfected with Myc-Usp25 together with the indicated plasmids encoding FLAG-IFIT1, FLAG-IFIT5, influenza FLAG-M2, and FLAG-M2 F91S (containing a mutation in its LC3-interacting region to prevent association with autophagosomes) were immunoprecipitated on anti-FLAG M2 affinity beads. The immunoprecipitates were analyzed by immunoblotting with anti-Myc to validate their interaction with Usp25. Transfected FLAG- tagged proteins were detected by immunoblotting the cell lysates (CL) with anti-FLAG. Gapdh was used as loading control. (G) A549 cells expressing either myc-BirA or myc-BirA-Usp25 cultured in biotin-supplemented media were either mock or H1N1pdm-infected. Lysates were captured on Neutravidin beads and eluates were immunoblotted for Erlin1 and Erlin2. (H and I) IAV-infected WT and Usp25/ cells were pulsed with [35S]cysteine/methionine for 10 min and chased in cold media for indicated time intervals in DMSO alone or 50 mM MG132-treated (o/n) cells. Erlin1 and Erlin2 were immunoprecipitated, resolved by SDS-PAGE and detected by autoradiography. Quantitation was performed as relative amounts normalized to the starting amount at t = 0. See also Figure S6.

Article Snippet: Vero ATCC CCL-81 Oligonucleotides GGCACCAAGGCACATAACGG (sgRNA) This study N/A GAGACTGAAAGATTACCTCA (sgRNA) This study N/A AGCAAAAGCAGG (uni-12) This study N/A AGTAGAAACAAGG (uni-13) This study N/A GACCAATCCTGTCACCTCTGA (M Gene-Forward) This study N/A AGGGCATTTTGGACAAAGCGTCTA (M Gene-Reverse) This study N/A CACCATTGGCAATGAGCGGTTC (b-actin-Forward) This study N/A AGGTCTTTGCGGATGTCCACGT (b-actin-Reverse) This study N/A Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) V2.0 Addgene Addgene plasmid #62988 Usp25-PX459 This study N/A Flag-tagged-Usp25 Xu et al.49 N/A Flag-tagged-Usp25 (C178S) Xu et al.49 N/A Myc-tagged- RIG I te Velthuis et al.50 N/A Flag-tagged-M2 This study N/A 3xFlag IFIT1 Addgene Addgene plasmid #53554 3xFlag IFIT5 Addgene Addgene plasmid #53556 HA-Ubiquitin Addgene Addgene plasmid #18712 HA-Ubiquitin-K6 Addgene Addgene plasmid #22900 HA-Ubiquitin-K11 Addgene Addgene plasmid #22901 HA-Ubiquitin-K27 Addgene Addgene plasmid #22902 HA-Ubiquitin-K29 Addgene Addgene plasmid #22903 HA-Ubiquitin-K33 Addgene Addgene plasmid #17607 HA-Ubiquitin-K48 Addgene Addgene plasmid #17605 HA-Ubiquitin-K63 Addgene Addgene plasmid #17606 mCherry-GFP-LC3 Addgene Addgene plasmid #110060 Myc-tagged-SMURF1 Addgene Addgene plasmid #13676 Flag-tagged-SMURF1 (C699A) Addgene Addgene plasmid #11753 VSV-G Addgene Addgene plasmid #8454 Software and Algorithms Prism 8.0 GraphPad Software https://www.graphpad.com/scientific- software/prism/ ImageJ NIH https://imagej.net/ImageJ ZEN confocal software Zeiss https://www.zeiss.com/microscopy/int/ products/microscope-software/zen.html FlowJo Flowjo https://www.flowjo.com/solutions/flowjo/ downloads Legendplex v8.0 Biolegend https://www.biolegend.com/en-us/ legendplex Ingenuity Pathway Analysis software QIAGEN https://digitalinsights.qiagen.com/ products-overview/discovery-insightsportfolio/analysis-and-visualization/ qiagen-ipa/ e3 Developmental Cell 58, 2495–2509.e1–e6, November 20, 2023

Techniques: Infection, Immunoprecipitation, Mass Spectrometry, Isolation, Expressing, FLAG-tag, Western Blot, Control, SDS Page, Autoradiography, Transfection, Mutagenesis, Cell Culture, Quantitation Assay

Schematic representation of plasmid map pAAV-FoxP4, pAAV-PRDM16, and pAAV-FST.

Journal: International Journal of Molecular Sciences

Article Title: Gene Therapy Approach for Treatment of Obese Agouti Mice

doi: 10.3390/ijms252212144

Figure Lengend Snippet: Schematic representation of plasmid map pAAV-FoxP4, pAAV-PRDM16, and pAAV-FST.

Article Snippet: The mouse PRDM16 gene was amplified from a commercially available plasmid, pcDNA3.1 PRDM16 (Addgene plasmid #15503; RRID: Addgene_15503).

Techniques: Plasmid Preparation

Progression of body weight change relative to weight before AAV administration in agouti mice treated at 12 weeks of age with an intra-WAT injection of empty AAV (Control), AAV-FoxP4, AAV-PRDM16, or AAV-FST vectors. Data are presented as mean ± S.D. values of three mice for each group. * p < 0.1 control group vs. AAV-FoxP4 group, # p < 0.1 control group vs. AAV-PRDM16 group, † p < 0.1 control group vs. AAV-FST group.

Journal: International Journal of Molecular Sciences

Article Title: Gene Therapy Approach for Treatment of Obese Agouti Mice

doi: 10.3390/ijms252212144

Figure Lengend Snippet: Progression of body weight change relative to weight before AAV administration in agouti mice treated at 12 weeks of age with an intra-WAT injection of empty AAV (Control), AAV-FoxP4, AAV-PRDM16, or AAV-FST vectors. Data are presented as mean ± S.D. values of three mice for each group. * p < 0.1 control group vs. AAV-FoxP4 group, # p < 0.1 control group vs. AAV-PRDM16 group, † p < 0.1 control group vs. AAV-FST group.

Article Snippet: The mouse PRDM16 gene was amplified from a commercially available plasmid, pcDNA3.1 PRDM16 (Addgene plasmid #15503; RRID: Addgene_15503).

Techniques: Injection, Control

The fold changes of the identified lipids between the AAV9-FST, AAV8-FoxP4, and AAV8-PRDM16 groups against the control (empty AAV). Fold change and p -value were calculated in Metaboanalyst 5.0 [ <xref ref-type= 15 ]. Lipids showing p -value > 0.05 are marked «Ns» (non-significant)." width="100%" height="100%">

Journal: International Journal of Molecular Sciences

Article Title: Gene Therapy Approach for Treatment of Obese Agouti Mice

doi: 10.3390/ijms252212144

Figure Lengend Snippet: The fold changes of the identified lipids between the AAV9-FST, AAV8-FoxP4, and AAV8-PRDM16 groups against the control (empty AAV). Fold change and p -value were calculated in Metaboanalyst 5.0 [ 15 ]. Lipids showing p -value > 0.05 are marked «Ns» (non-significant).

Article Snippet: The mouse PRDM16 gene was amplified from a commercially available plasmid, pcDNA3.1 PRDM16 (Addgene plasmid #15503; RRID: Addgene_15503).

Techniques: Control